بررسی وجود ژن اسکوالن اپوکسیداز- قسمت ۱۰

بررسی وجود ژن اسکوالن اپوکسیداز- قسمت ۱۰

به طور کلی گونه‌های ترایکوفایتون به ۷ گروه تقسیم شده‌اند و یک درخت فیلوژنتیکی براساس اختلاف در توالی mtDNA بوجود آمده است.
با تجزیه و تحلیل‌های انجام گرفته بر روی ITS1های rDNA ارتباط فیلوژنتیکی بین جنسهای درماتوفیت یعنی میکروسپوروم، اپیدرموفایتون و ترایکوفایتون مشخص گردیده است. (۷۲) گونه‌های ترایکوفایتون و میکروسپوروم تشکیل یک شاخه و اپیدرموفایتون تشکیل شاخه دیگری را می‌دهد و همه گونه‌های ترایکوفایتون بجز T. terrestre تشکیل یک زیرشاخه را می‌دهند. اعضاء درماتوفیتها براساس همولوژی‌های ITS به سه گروه تقسیم شده‌اند:

  1. گروهArthroderma vanbreuseghemii-simii

شامل Tmentagrophytes Var. quin ckeanum و (جدا شده از انسان) T. mentagrophytes و A. Simii و A. vanbreuseghemii و T. tonsurans و T. schoenleinii. (41)

  1. گروهArthroderma benhamiae

شامل: T. mentagrophytes, var. erinacei, T. verrucossum که RFLP، منطقه NTS، rDNA، ۵ نوع DNA را نشان می‌دهند. (۴۷)

  1. گروه T. rubrum که به دو تیپ Iو IIتقسیم می‌شود.(۴۱)

نکته دیگر این است که جهت قارچها به پرایمرهای ویژه خاصی اهمیت داده شده است و این پرایمرها باید برای این ارگانیسم‌ها اختصاصی باشند و با DNA سایریوکاریوتها هیبرید نشوند. این پرایمرها باعث تکثیر نواحی خاصی از DNA قارچ می‌شوند.
در حال حاضر یک سیستم پرایمری وجود دارد که قطعه‌ای از ژن کدکننده زیرواحد کوچک ریبوزومی rRNA S18 را تکثیر می‌کند.
معمولاً پرایمرهای TR1 با توالی ۵GTTTCTAGGACCGCCGTA3′ و نیز TR2 با توالی ۵CTCAAACTTCCATCGACTTG3′ با توالی‌های قارچها متصل می‌گردد و نسبت به قطعات DNA جانوران و گیاهان کاملاً متفاوتند.
درماتوفیتها از نظر فیلوژنتیکی و تاکسونومی بسیار نزدیک و وابسته به یکدیگرند. مطالعات بیولوژیک فیلوژنی قارچها ابتدا با بررسی محتوای G+C از DNA کروموزومی، همولوژی کل DNA و آنالیز پلی‌مرفسیم طول بخش برش دهنده حاصل از DNA میتوکندریایی و تکثیر تصادفی DNA پلی‌مرفیک و تعیین سکانس بر پایه rRNA S18 یاS28 انجام شده، اما این روشها را نمی‌توان جهت طبقه‌بندی استفاده کرد.
ITSها که در بین rDNAهای S18 و S8/5 قرار دارند جهت‌طبقه‌بندی درماتوفیتها مناسب هستند.
با بررسی مناطقITS، T.rubrum و T.mentagrophytes جدا شده از بیماران دارای کچلی ناخن، به این نتیجه رسیدند که بیماران هیچ ژنوتیپ یکسانی نداشتند و در بررسی Gupta.AK و همکاران در سال ۲۰۰۱، حتی نمونه‌هایی که از ناخن‌های مختلف یک بیمار نیز به دست آمده بودند، ژنوتیپ‌های مختلف را نشان دادند.(۲۸)
liuD و همکاران در سال ۱۹۹۷ از پرایمرهای تصادفی۵ ACCCGA CCTG3(OPAA11) در روش AP-PCR جهت اختلاف T.rubrum و T.mentagrophytes استفاده کردند.(۳۸)
البته اثراندونوکلئازهای HaeIII، MspI، HindIII، XbaI و BgiII در گوناگونی DNA میتوکندریایی (mtDNA) ترایکوفایتون‌ها بررسی شده است و آنالیز mtDNA برای تشخیص پلئومرفیک گونه‌ها مفید است.(۵۰)
همچنین اختلاف T. tonsurans با T. mentagrophytes با استفاده از پرایمر ۵-GAAGGCTCCC-3 (OPAO-15) بررسی شد، اما با این پرایمرها اختلاف بین خود T.tonsurans نشان داده نمی‌شود و این بیانگر آن است که عموماً گونه‌های این قارچ صرفنظر از محل جداسازی آنها دارای ویژگی‌ مرفولوژی و فیزیولوژی و همولوگ یکسان هستند. دوپرایمر ۵[GGTGCGGGAA]3 و ۵-d[CCCGTCAGCA]-3 نیز بخوبی برای مناطق NTS ، rDNA شناسایی شده‌اند.(۳)
با استفاده از RT-PCR، ژن ALP1 را نیز در T.tonsurans شناسایی کرده‌اند. (۴)
PCR روش خوبی برای تشخیص گونه‌های غیرشاخص است و در مقابل روش آزمایشگاهی که کند است، روش خوبی است.
۴ پرایمر تصادفی ۱۱OPAA و ۱۸OPD و ۱۷OPAA و ۱۵OPU در روش AP-PCR بکار رفته و ۲۵-۲۰ گونه و زیرگونه درماتوفیتها تشخیص داده‌شده‌‌اند. البته با ترکیب ۱۸OPD و ۱۷OPAA نیز همین نتیجه به دست آمد.(۳۹)
در کل این روشهای مولکولی بسیار خوب هستند چرا که در بررسی Brilhanteks و Cordei rora در سال ۲۰۰۶، روی M.canis که یکی از گونه‌های معمول جدا شده از درماتوفیتهای سگ و گربه است ، در مواردی درماتوفیتهای انسان دوست T.violaceum نیز جدا کرده‌اند، که این یکسان بودن ویژگی ژنتیکی را با آنزیمهای تحدیدی Sau3A و RsaI و DdeI و EcoRI و کار روی ITSها بررسی کرده‌اند. سازش پذیری گونه انسان دوست با شرایط حیوانی جای بحث دارد.(۱۰)
البته از روشهای مولکولی مانند RAPD جهت روند درمان بیماری و مقاومت دارویی استفاده شده که این عمل در مورد بیماری اونیکومیکوزیس در افراد بیمار دارای نقص ایمنی بررسی شده و عامل همه آنها Trubrum بوده و اختلاف ژنتیکی بین اینها مشاهده نمی‌شود و الگوی DNA آنها یکسان بوده است. البته با استفاده از سایر آنالیزهای ژنتیکی بر پایه DNA میتوکندریایی امکان تشخیص ژنوتیپهای مختلف T. rubrum وجود دارد.(۱۵)r/>با استفاده از روشهای مولکولی و آنالیز توالی مناطق ITS ۱ و ۲ (cDNA)، DNA هسته‌ای جهت کشف فیلوژنی درماتوفیت ها استفاده شده است و نتایج نشان می‌دهد که تعداد گونه‌های درماتوفیت نسبت به سایر گونه‌های ثابت شده کاهش می‌یابد، و در این بررسی‌ها نشان داده شده Tequinum که شباهتش با گونه‌های انسان دوست T. tonsurans کمتر است ، با بررسی‌های توالی‌های ITS این دو نوع، به دودمان مشترک آنها رسیده‌اند.(۷۸)علیرغم اینکه یکی حیوان دوست و دیگری انسان‌دوست است اما از لحاظ توالی ITS اختلاف کمی دارند و از اینرو جهت تشخیص وقایع تکاملی بررسی می‌شوند.(۴۴)
از روشهای مولکولی AFLP و PCR-fingerprinting جهت بررسیITS ، برای مقایسه شکلهای مرفولوژیکی و فیزیولوژیکی درماتوفیت‌ها استفاده می‌کنند که طی آن T. mentagrophytes و T. tonsurans که قبلاً در ۲۴ گونه مختلف تشخیص داده شده بودند را می‌توان به ۵ گروه کاهش داد و مجدداً طبقه‌بندی کرد و با T. tonsurans، Tinterdigitale، T. mentagrophytes، T. simii و T. erinacei همراه نمود.(۲۶)
تشخیص سریع T. violaceumتوسط PCR بویژه بر پایه توالی (ITS)DNA بررسی شده است. جهت این موضوع جفت پرایمرهای ویژه طراحی شده و با این روش قادر به تشخیص pg10 از DNA ژنومی T. violaceumهستند، و این روش، روشی سریع، حساس و ویژه است. (۸۰)

منبع فایل کامل این پایان نامه این سایت pipaf.ir است

  1. violaceumیک عامل پاتوژن عمده کچلی سر است که سبب بیماریهای مختلفی می‌گردد .اطلاعات در مورد انواع ژنتیکی آنها کم است و جهت بررسی این عامل از روش تکثیر PCRمناطق NTSو Nested مناطق VIR ونیز جهت تعیین زیر واریته ها روش RFLP استفاده شده است، وطی آن ۵ نوع مختلف از نظر اندازه bp700-348 شناسایی و نیز توالی‌های آنها تشخیص داده شده‌اند. در منطقه VIR هفت توالی تکراری بزرگ bp104، ۱۴۰ و ۱۹۴ که پشت سرهم ردیف شده‌اند و ۷ پلی‌مرفیسم تک نوکلئوتیدی (SNPs) در بین NTS تشخیص داده‌ شده‌اند که ۵ منطقه ثابت، کنار منطقه VIR و دو منطقه در VIR واقع شده است. بعلاوه یک قطعه bp10 متصل و یک قطعه bp14 حذف شده در منطقه بالا دست VIR، تشخیص داده شده است. ۷ الگوی هاپلوتیپی (SNPs) طی پاساژهای متوالی بیش از یکسال ثابت است و هیچ اختلاف توالی بین ITS آنها تشخیص داده نشده است. در تشخیص T. violaceumاز سایر درماتوفیتها از توالی NTS در سنجش به روش PCR دوبل نیز استفاده می‌شود.(۲۲)

جالب توجه آن است که از روش مولکولی RAPD جهت شناسایی و یکسان بودن ویژگی‌های ژنتیکی T. violaceumاستفاده شده و تمام گونه‌های تست شده درماتوفیت در این آزمایش، اختلاف باند با یکدیگر را نشان می‌دهند اما هیچ اختلاف باندی در بین تمام گونه‌های T. violaceumدیده نشده و آنچه که قابل توجه بود این است که T. violaceumصرفنظر از منطقه جدا شده، مرفولوژی و ویژگی‌های فیزیولوژی گونه‌های آن، از نظر ژنتیکی یکسان بودند. (۳۴)
همچنین از PCR، mRNA آکتین درماتوفیتها جهت تشخیص و ارزیابی قدرت حیات عوامل عفونتهای ناخن استفاده شده است، چرا که گاهی اوقات، کشتهای منفی کاذب، درمان را مشکل می‌سازد. همچنین از RTPCR نیز در این مورد استفاده شده است .همچنین یک قسمت توالی اینترون ژن کدکننده آکتین جدا شده و قطعه ترجمه شده توسط PCRnested شناسایی گردیده است.(۶۶)
از این‌رو تشخیص سریع درماتوفیتها توسط روشهای مولکولی، توسعه و پیشرفت این عفونتها را کند کرده است. تعیین توالی ژنوم، ما را قادر خواهد ساخت که ویرولانس و دیگر آنتی‌ژنها و پروتئین‌های مهم واکنش قارچ- میزبان و ویژگی میزبانی را شناخته و در ضمن با تعیین توالی می‌توانیم پی ببریم که چرا قارچ‌های انسان‌دوست سبب عفونتهای مزمن می‌شوند در حالیکه قارچ‌های حیوان‌دوست و خاک‌دوست سبب عفونت حاد و التهابی می‌شوند. همچنین توالی ژنومی موجب یافتن نقشه اپی‌توپ و آنالیز پروتئین‌های سطحی و مترشحه و ساخت واکسن‌های قوی برای جلوگیری یا کنترل بیماری و عفونت می‌گردد.(۴۴)

مدیر سایت